Scientific Jaspar Database
Query JASPAR for transcription factor binding site (TFBS) profiles (PWMs/PFMs). Search by TF name, species, or class; scan DNA sequences for TF binding sites; compare matrices; essential for regulatory genomics, motif analysis, and GWAS regulatory...
Your ChIP-seq peaks show enrichment but you need to know which transcription factors bind those regions. JASPAR provides curated position weight matrices for thousands of TF binding profiles — the standard resource for scanning DNA sequences, identifying regulatory motifs, and interpreting non-coding GWAS variants.
Who it's for: regulatory genomicists scanning DNA sequences for transcription factor binding motifs, epigenomics researchers interpreting ChIP-seq and ATAC-seq peaks with TF binding profiles, computational biologists building gene regulatory network models, human geneticists analyzing non-coding GWAS variants for regulatory disruption, systems biologists mapping transcription factor binding across promoters and enhancers
Example
"Scan our ATAC-seq peak sequences for enriched transcription factor binding motifs" → JASPAR workflow: TF binding profile retrieval by species and structural class, position weight matrix scanning across peak sequences, enrichment analysis comparing to background, motif comparison and clustering of co-occurring TFs, and a regulatory motif report with binding site locations and significance scores
New here? 3-minute setup guide → | Already set up? Copy the template below.
# JASPAR Database
## Overview
JASPAR (https://jaspar.elixir.no/) is the gold-standard open-access database of curated, non-redundant transcription factor (TF) binding profiles stored as position frequency matrices (PFMs). JASPAR 2024 contains 1,210 non-redundant TF binding profiles for 164 eukaryotic species. Each profile is experimentally derived (ChIP-seq, SELEX, HT-SELEX, protein binding microarray, etc.) and rigorously validated.
**Key resources:**
- JASPAR portal: https://jaspar.elixir.no/
- REST API: https://jaspar.elixir.no/api/v1/
- API docs: https://jaspar.elixir.no/api/v1/docs/
- Python package: `jaspar` (via Biopython) or direct API
## When to Use This Skill
Use JASPAR when:
- **TF binding site prediction**: Scan a DNA sequence for potential binding sites of a TF
- **Regulatory variant interpretation**: Does a GWAS/eQTL variant disrupt a TF binding motif?
- **Promoter/enhancer analysis**: What TFs are predicted to bind to a regulatory element?
- **Gene regulatory network construction**: Link TFs to their target genes via motif scanning
- **TF family analysis**: Compare binding profiles across a TF family (e.g., all homeobox factors)
- **ChIP-seq analysis**: Find known TF motifs enriched in ChIP-seq peaks
- **ENCODE/ATAC-seq interpretation**: Match open chromatin regions to TF binding profiles
## Core Capabilities
### 1. JASPAR REST API
Base URL: `https://jaspar.elixir.no/api/v1/`
```python
import requests
BASE_URL = "https://jaspar.elixir.no/api/v1"
def jaspar_get(endpoint, params=None):
url = f"{BASE_URL}/{endpoint}"
response = requests.get(url, params=params, headers={"Accept": "application/json"})
response.raise_for_status()
return response.json()
```
### 2. Search for TF Profiles
```python
def search_jaspar(
tf_name=None,
species=None,
collection="CORE",
tf_class=None,
tf_family=None,
page=1,
page_size=25
):
"""Search JASPAR for TF binding profiles."""
params = {
"collection": collection,
"page": page,
"page_size": page_size,
"format": "json"
}
if tf_name:
params["name"] = tf_name
if species:
params["species"] = species # Use taxonomy ID or name, e.g., "9606" for human
if tf_class:
params["tf_class"] = tf_class
if tf_family:
params["tf_family"] = tf_family
return jaspar_get("matrix", params)
# Examples:
# Search for human CTCF profile
ctcf = search_jaspar("CTCF", species="9606")
print(f"Found {ctcf['count']} CTCF profiles")
# Search for all homeobox TFs in human
hox_tfs = search_jaspar(tf_class="Homeodomain", species="9606")
# Search for a TF family
nfkb = search_jaspar(tf_family="NF-kappaB")
```
### 3. Fetch a Specific Matrix (PFM/PWM)
```python
def get_matrix(matrix_id):
"""Fetch a specific JASPAR matrix by ID (e.g., 'MA0139.1' for CTCF)."""
return jaspar_get(f"matrix/{matrix_id}/")
# Example: Get CTCF matrix
ctcf_matrix = get_matrix("MA0139.1")
# Matrix structure:
# {
# "matrix_id": "MA0139.1",
# "name": "CTCF",
# "collection": "CORE",
# "tax_group": "vertebrates",
# "pfm": { "A": [...], "C": [...], "G": [...], "T": [...] },
# "consensus": "CCGCGNGGNGGCAG",
# "length": 19,
# "species": [{"tax_id": 9606, "name": "Homo sapiens"}],
# "class": ["C2H2 zinc finger factors"],
# "family": ["BEN domain factors"],
# "type": "ChIP-seq",
# "uniprot_ids": ["P49711"]
# }
```
### 4. Download PFM/PWM as Matrix
```python
import numpy as np
def get_pwm(matrix_id, pseudocount=0.8):
"""
Fetch a PFM from JASPAR and convert to PWM (log-odds).
Returns numpy array of shape (4, L) in order A, C, G, T.
"""
matrix = get_matrix(matrix_id)
pfm = matrix["pfm"]
# Convert PFM to numpy
pfm_array = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float)
# Add pseudocount
pfm_array += pseudocount
# Normalize to get PPM
ppm = pfm_array / pfm_array.sum(axis=0, keepdims=True)
# Convert to PWM (log-odds relative to background 0.25)
background = 0.25
pwm = np.log2(ppm / background)
return pwm, matrix["name"]
# Example
pwm, name = get_pwm("MA0139.1") # CTCF
print(f"PWM for {name}: shape {pwm.shape}")
max_score = pwm.max(axis=0).sum()
print(f"Maximum possible score: {max_score:.2f} bits")
```
### 5. Scan a DNA Sequence for TF Binding Sites
```python
import numpy as np
from typing import List, Tuple
NUCLEOTIDE_MAP = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
def scan_sequence(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8) -> List[dict]:
"""
Scan a DNA sequence for TF binding sites using a PWM.
Args:
sequence: DNA sequence string
pwm: PWM array (4 x L) in ACGT order
threshold_pct: Fraction of max score to use as threshold (0-1)
Returns:
List of hits with position, score, and matched sequence
"""
motif_len = pwm.shape[1]
max_score = pwm.max(axis=0).sum()
min_score = pwm.min(axis=0).sum()
threshold = min_score + threshold_pct * (max_score - min_score)
hits = []
seq = sequence.upper()
for i in range(len(seq) - motif_len + 1):
subseq = seq[i:i + motif_len]
# Skip if contains non-ACGT
if any(c not in NUCLEOTIDE_MAP for c in subseq):
continue
score = sum(pwm[NUCLEOTIDE_MAP[c], j] for j, c in enumerate(subseq))
if score >= threshold:
relative_score = (score - min_score) / (max_score - min_score)
hits.append({
"position": i + 1, # 1-based
"score": score,
"relative_score": relative_score,
"sequence": subseq,
"strand": "+"
})
return hits
# Example: Scan a promoter sequence for CTCF binding sites
promoter = "AGCCCGCGAGGNGGCAGTTGCCTGGAGCAGGATCAGCAGATC"
pwm, name = get_pwm("MA0139.1")
hits = scan_sequence(promoter, pwm, threshold_pct=0.75)
for hit in hits:
print(f" Position {hit['position']}: {hit['sequence']} (score: {hit['score']:.2f}, {hit['relative_score']:.0%})")
```
### 6. Scan Both Strands
```python
def reverse_complement(seq: str) -> str:
complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'N': 'N'}
return ''.join(complement.get(b, 'N') for b in reversed(seq.upper()))
def scan_both_strands(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8):
"""Scan forward and reverse complement strands."""
fwd_hits = scan_sequence(sequence, pwm, threshold_pct)
for h in fwd_hits:
h["strand"] = "+"
rev_seq = reverse_complement(sequence)
rev_hits = scan_sequence(rev_seq, pwm, threshold_pct)
seq_len = len(sequence)
for h in rev_hits:
h["strand"] = "-"
h["position"] = seq_len - h["position"] - len(h["sequence"]) + 2 # Convert to fwd coords
all_hits = fwd_hits + rev_hits
return sorted(all_hits, key=lambda x: x["position"])
```
### 7. Variant Impact on TF Binding
```python
def variant_tfbs_impact(ref_seq: str, alt_seq: str, pwm: np.ndarray,
tf_name: str, threshold_pct: float = 0.7):
"""
Assess impact of a SNP on TF binding by comparing ref vs alt sequences.
Both sequences should be centered on the variant with flanking context.
"""
ref_hits = scan_both_strands(ref_seq, pwm, threshold_pct)
alt_hits = scan_both_strands(alt_seq, pwm, threshold_pct)
max_ref = max((h["score"] for h in ref_hits), default=None)
max_alt = max((h["score"] for h in alt_hits), default=None)
result = {
"tf": tf_name,
"ref_max_score": max_ref,
"alt_max_score": max_alt,
"ref_has_site": len(ref_hits) > 0,
"alt_has_site": len(alt_hits) > 0,
}
if max_ref and max_alt:
result["score_change"] = max_alt - max_ref
result["effect"] = "gained" if max_alt > max_ref else "disrupted"
elif max_ref and not max_alt:
result["effect"] = "disrupted"
elif not max_ref and max_alt:
result["effect"] = "gained"
else:
result["effect"] = "no_site"
return result
```
## Query Workflows
### Workflow 1: Find All TF Binding Sites in a Promoter
```python
import requests, numpy as np
# 1. Get relevant TF matrices (e.g., all human TFs in CORE collection)
response = requests.get(
"https://jaspar.elixir.no/api/v1/matrix/",
params={"species": "9606", "collection": "CORE", "page_size": 500, "page": 1}
)
matrices = response.json()["results"]
# 2. For each matrix, compute PWM and scan promoter
promoter = "CCCGCCCGCCCGCCGCCCGCAGTTAATGAGCCCAGCGTGCC" # Example
all_hits = []
for m in matrices[:10]: # Limit for demo
pwm_data = requests.get(f"https://jaspar.elixir.no/api/v1/matrix/{m['matrix_id']}/").json()
pfm = pfm_data["pfm"]
pfm_arr = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float) + 0.8
ppm = pfm_arr / pfm_arr.sum(axis=0)
pwm = np.log2(ppm / 0.25)
hits = scan_sequence(promoter, pwm, threshold_pct=0.8)
for h in hits:
h["tf_name"] = m["name"]
h["matrix_id"] = m["matrix_id"]
all_hits.extend(hits)
print(f"Found {len(all_hits)} TF binding sites")
for h in sorted(all_hits, key=lambda x: -x["score"])[:5]:
print(f" {h['tf_name']} ({h['matrix_id']}): pos {h['position']}, score {h['score']:.2f}")
```
### Workflow 2: SNP Impact on TF Binding (Regulatory Variant Analysis)
1. Retrieve the genomic sequence flanking the SNP (±20 bp each side)
2. Construct ref and alt sequences
3. Scan with all relevant TF PWMs
4. Report TFs whose binding is created or destroyed by the SNP
### Workflow 3: Motif Enrichment Analysis
1. Identify a set of peak sequences (e.g., from ChIP-seq or ATAC-seq)
2. Scan all peaks with JASPAR PWMs
3. Compare hit rates in peaks vs. background sequences
4. Report significantly enriched motifs (Fisher's exact test or FIMO-style scoring)
## Collections Available
| Collection | Description | Profiles |
|------------|-------------|----------|
| `CORE` | Non-redundant, high-quality profiles | ~1,210 |
| `UNVALIDATED` | Experimentally derived but not validated | ~500 |
| `PHYLOFACTS` | Phylogenetically conserved sites | ~50 |
| `CNE` | Conserved non-coding elements | ~30 |
| `POLII` | RNA Pol II binding profiles | ~20 |
| `FAM` | TF family representative profiles | ~170 |
| `SPLICE` | Splice factor profiles | ~20 |
## Best Practices
- **Use CORE collection** for most analyses — best validated and non-redundant
- **Threshold selection**: 80% of max score is common for de novo prediction; 90% for high-confidence
- **Always scan both strands** — TFs can bind in either orientation
- **Provide flanking context** for variant analysis: at least (motif_length - 1) bp on each side
- **Consider background**: PWM scores relative to uniform (0.25) background; adjust for actual GC content
- **Cross-validate with ChIP-seq data** when available — motif scanning has many false positives
- **Use Biopython's motifs module** for full-featured scanning: `from Bio import motifs`
## Additional Resources
- **JASPAR portal**: https://jaspar.elixir.no/
- **API documentation**: https://jaspar.elixir.no/api/v1/docs/
- **JASPAR 2024 paper**: Castro-Mondragon et al. (2022) Nucleic Acids Research. PMID: 34875674
- **Biopython motifs**: https://biopython.org/docs/latest/Tutorial/chapter_motifs.html
- **FIMO tool** (for large-scale scanning): https://meme-suite.org/meme/tools/fimo
- **HOMER** (motif enrichment): http://homer.ucsd.edu/homer/
- **GitHub**: https://github.com/wassermanlab/JASPAR-UCSC-tracksWhat This Does
JASPAR (https://jaspar.elixir.no/) is the gold-standard open-access database of curated, non-redundant transcription factor (TF) binding profiles stored as position frequency matrices (PFMs). JASPAR 2024 contains 1,210 non-redundant TF binding profiles for 164 eukaryotic species. Each profile is experimentally derived (ChIP-seq, SELEX, HT-SELEX, protein binding microarray, etc.) and rigorously validated.
Key resources:
- JASPAR portal: https://jaspar.elixir.no/
- REST API: https://jaspar.elixir.no/api/v1/
- API docs: https://jaspar.elixir.no/api/v1/docs/
- Python package:
jaspar(via Biopython) or direct API
Quick Start
Step 1: Create a Project Folder
mkdir -p ~/Projects/jaspar-database
Step 2: Download the Template
Click Download above, then:
mv ~/Downloads/CLAUDE.md ~/Projects/jaspar-database/
Step 3: Start Claude Code
cd ~/Projects/jaspar-database
claude
Core Capabilities
1. JASPAR REST API
Base URL: https://jaspar.elixir.no/api/v1/
import requests
BASE_URL = "https://jaspar.elixir.no/api/v1"
def jaspar_get(endpoint, params=None):
url = f"{BASE_URL}/{endpoint}"
response = requests.get(url, params=params, headers={"Accept": "application/json"})
response.raise_for_status()
return response.json()
2. Search for TF Profiles
def search_jaspar(
tf_name=None,
species=None,
collection="CORE",
tf_class=None,
tf_family=None,
page=1,
page_size=25
):
"""Search JASPAR for TF binding profiles."""
params = {
"collection": collection,
"page": page,
"page_size": page_size,
"format": "json"
}
if tf_name:
params["name"] = tf_name
if species:
params["species"] = species # Use taxonomy ID or name, e.g., "9606" for human
if tf_class:
params["tf_class"] = tf_class
if tf_family:
params["tf_family"] = tf_family
return jaspar_get("matrix", params)
# Examples:
# Search for human CTCF profile
ctcf = search_jaspar("CTCF", species="9606")
print(f"Found {ctcf['count']} CTCF profiles")
# Search for all homeobox TFs in human
hox_tfs = search_jaspar(tf_class="Homeodomain", species="9606")
# Search for a TF family
nfkb = search_jaspar(tf_family="NF-kappaB")
3. Fetch a Specific Matrix (PFM/PWM)
def get_matrix(matrix_id):
"""Fetch a specific JASPAR matrix by ID (e.g., 'MA0139.1' for CTCF)."""
return jaspar_get(f"matrix/{matrix_id}/")
# Example: Get CTCF matrix
ctcf_matrix = get_matrix("MA0139.1")
# Matrix structure:
# {
# "matrix_id": "MA0139.1",
# "name": "CTCF",
# "collection": "CORE",
# "tax_group": "vertebrates",
# "pfm": { "A": [...], "C": [...], "G": [...], "T": [...] },
# "consensus": "CCGCGNGGNGGCAG",
# "length": 19,
# "species": [{"tax_id": 9606, "name": "Homo sapiens"}],
# "class": ["C2H2 zinc finger factors"],
# "family": ["BEN domain factors"],
# "type": "ChIP-seq",
# "uniprot_ids": ["P49711"]
# }
4. Download PFM/PWM as Matrix
import numpy as np
def get_pwm(matrix_id, pseudocount=0.8):
"""
Fetch a PFM from JASPAR and convert to PWM (log-odds).
Returns numpy array of shape (4, L) in order A, C, G, T.
"""
matrix = get_matrix(matrix_id)
pfm = matrix["pfm"]
# Convert PFM to numpy
pfm_array = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float)
# Add pseudocount
pfm_array += pseudocount
# Normalize to get PPM
ppm = pfm_array / pfm_array.sum(axis=0, keepdims=True)
# Convert to PWM (log-odds relative to background 0.25)
background = 0.25
pwm = np.log2(ppm / background)
return pwm, matrix["name"]
# Example
pwm, name = get_pwm("MA0139.1") # CTCF
print(f"PWM for {name}: shape {pwm.shape}")
max_score = pwm.max(axis=0).sum()
print(f"Maximum possible score: {max_score:.2f} bits")
5. Scan a DNA Sequence for TF Binding Sites
import numpy as np
from typing import List, Tuple
NUCLEOTIDE_MAP = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
def scan_sequence(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8) -> List[dict]:
"""
Scan a DNA sequence for TF binding sites using a PWM.
Args:
sequence: DNA sequence string
pwm: PWM array (4 x L) in ACGT order
threshold_pct: Fraction of max score to use as threshold (0-1)
Returns:
List of hits with position, score, and matched sequence
"""
motif_len = pwm.shape[1]
max_score = pwm.max(axis=0).sum()
min_score = pwm.min(axis=0).sum()
threshold = min_score + threshold_pct * (max_score - min_score)
hits = []
seq = sequence.upper()
for i in range(len(seq) - motif_len + 1):
subseq = seq[i:i + motif_len]
# Skip if contains non-ACGT
if any(c not in NUCLEOTIDE_MAP for c in subseq):
continue
score = sum(pwm[NUCLEOTIDE_MAP[c], j] for j, c in enumerate(subseq))
if score >= threshold:
relative_score = (score - min_score) / (max_score - min_score)
hits.append({
"position": i + 1, # 1-based
"score": score,
"relative_score": relative_score,
"sequence": subseq,
"strand": "+"
})
return hits
# Example: Scan a promoter sequence for CTCF binding sites
promoter = "AGCCCGCGAGGNGGCAGTTGCCTGGAGCAGGATCAGCAGATC"
pwm, name = get_pwm("MA0139.1")
hits = scan_sequence(promoter, pwm, threshold_pct=0.75)
for hit in hits:
print(f" Position {hit['position']}: {hit['sequence']} (score: {hit['score']:.2f}, {hit['relative_score']:.0%})")
6. Scan Both Strands
def reverse_complement(seq: str) -> str:
complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'N': 'N'}
return ''.join(complement.get(b, 'N') for b in reversed(seq.upper()))
def scan_both_strands(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8):
"""Scan forward and reverse complement strands."""
fwd_hits = scan_sequence(sequence, pwm, threshold_pct)
for h in fwd_hits:
h["strand"] = "+"
rev_seq = reverse_complement(sequence)
rev_hits = scan_sequence(rev_seq, pwm, threshold_pct)
seq_len = len(sequence)
for h in rev_hits:
h["strand"] = "-"
h["position"] = seq_len - h["position"] - len(h["sequence"]) + 2 # Convert to fwd coords
all_hits = fwd_hits + rev_hits
return sorted(all_hits, key=lambda x: x["position"])
7. Variant Impact on TF Binding
def variant_tfbs_impact(ref_seq: str, alt_seq: str, pwm: np.ndarray,
tf_name: str, threshold_pct: float = 0.7):
"""
Assess impact of a SNP on TF binding by comparing ref vs alt sequences.
Both sequences should be centered on the variant with flanking context.
"""
ref_hits = scan_both_strands(ref_seq, pwm, threshold_pct)
alt_hits = scan_both_strands(alt_seq, pwm, threshold_pct)
max_ref = max((h["score"] for h in ref_hits), default=None)
max_alt = max((h["score"] for h in alt_hits), default=None)
result = {
"tf": tf_name,
"ref_max_score": max_ref,
"alt_max_score": max_alt,
"ref_has_site": len(ref_hits) > 0,
"alt_has_site": len(alt_hits) > 0,
}
if max_ref and max_alt:
result["score_change"] = max_alt - max_ref
result["effect"] = "gained" if max_alt > max_ref else "disrupted"
elif max_ref and not max_alt:
result["effect"] = "disrupted"
elif not max_ref and max_alt:
result["effect"] = "gained"
else:
result["effect"] = "no_site"
return result
Query Workflows
Workflow 1: Find All TF Binding Sites in a Promoter
import requests, numpy as np
# 1. Get relevant TF matrices (e.g., all human TFs in CORE collection)
response = requests.get(
"https://jaspar.elixir.no/api/v1/matrix/",
params={"species": "9606", "collection": "CORE", "page_size": 500, "page": 1}
)
matrices = response.json()["results"]
# 2. For each matrix, compute PWM and scan promoter
promoter = "CCCGCCCGCCCGCCGCCCGCAGTTAATGAGCCCAGCGTGCC" # Example
all_hits = []
for m in matrices[:10]: # Limit for demo
pwm_data = requests.get(f"https://jaspar.elixir.no/api/v1/matrix/{m['matrix_id']}/").json()
pfm = pfm_data["pfm"]
pfm_arr = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float) + 0.8
ppm = pfm_arr / pfm_arr.sum(axis=0)
pwm = np.log2(ppm / 0.25)
hits = scan_sequence(promoter, pwm, threshold_pct=0.8)
for h in hits:
h["tf_name"] = m["name"]
h["matrix_id"] = m["matrix_id"]
all_hits.extend(hits)
print(f"Found {len(all_hits)} TF binding sites")
for h in sorted(all_hits, key=lambda x: -x["score"])[:5]:
print(f" {h['tf_name']} ({h['matrix_id']}): pos {h['position']}, score {h['score']:.2f}")
Workflow 2: SNP Impact on TF Binding (Regulatory Variant Analysis)
- Retrieve the genomic sequence flanking the SNP (±20 bp each side)
- Construct ref and alt sequences
- Scan with all relevant TF PWMs
- Report TFs whose binding is created or destroyed by the SNP
Workflow 3: Motif Enrichment Analysis
- Identify a set of peak sequences (e.g., from ChIP-seq or ATAC-seq)
- Scan all peaks with JASPAR PWMs
- Compare hit rates in peaks vs. background sequences
- Report significantly enriched motifs (Fisher's exact test or FIMO-style scoring)
Collections Available
| Collection | Description | Profiles |
|---|---|---|
CORE |
Non-redundant, high-quality profiles | ~1,210 |
UNVALIDATED |
Experimentally derived but not validated | ~500 |
PHYLOFACTS |
Phylogenetically conserved sites | ~50 |
CNE |
Conserved non-coding elements | ~30 |
POLII |
RNA Pol II binding profiles | ~20 |
FAM |
TF family representative profiles | ~170 |
SPLICE |
Splice factor profiles | ~20 |
Best Practices
- Use CORE collection for most analyses — best validated and non-redundant
- Threshold selection: 80% of max score is common for de novo prediction; 90% for high-confidence
- Always scan both strands — TFs can bind in either orientation
- Provide flanking context for variant analysis: at least (motif_length - 1) bp on each side
- Consider background: PWM scores relative to uniform (0.25) background; adjust for actual GC content
- Cross-validate with ChIP-seq data when available — motif scanning has many false positives
- Use Biopython's motifs module for full-featured scanning:
from Bio import motifs
Additional Resources
- JASPAR portal: https://jaspar.elixir.no/
- API documentation: https://jaspar.elixir.no/api/v1/docs/
- JASPAR 2024 paper: Castro-Mondragon et al. (2022) Nucleic Acids Research. PMID: 34875674
- Biopython motifs: https://biopython.org/docs/latest/Tutorial/chapter_motifs.html
- FIMO tool (for large-scale scanning): https://meme-suite.org/meme/tools/fimo
- HOMER (motif enrichment): http://homer.ucsd.edu/homer/
- GitHub: https://github.com/wassermanlab/JASPAR-UCSC-tracks